Antibodies
Anti-ARG2 Antibody-Oligo Conjugate
SKU: aoc1234
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ARG2 Antibody-IF1
Antibody Target
- Target
- Arginase-2, mitochondrial
- UniProt Number
- P78540
- Target Description
- May play a role in the regulation of extra-urea cycle arginine metabolism and also in down-regulation of nitric oxide synthesis. Extrahepatic arginase functions to regulate L-arginine bioavailability to nitric oxid synthase (NOS). Arginine metabolism is a critical regulator of innate and adaptive immune responses. Seems to be involved in negative regulation of the survival capacity of activated CD4(+) and CD8(+) T cells. May suppress inflammation-related signaling in asthmatic airway epithelium. May contribute to the immune evasion of H.pylori by restricting M1 macrophage activation and polyamine metabolism. In fetal dendritic cells may play a role in promoting immune suppression and T cell TNF-alpha production during gestation. Regulates RPS6KB1 signaling, which promotes endothelial cell senescence and inflammation and implicates NOS3/eNOS dysfunction. Can inhibit endothelial autophagy independently of its enzymatic activity implicating mTORC2 signaling. Involved in vascular smooth muscle cell senescence and apoptosis independently of its enzymatic activity. Since NOS is found in the penile corpus cavernosum smooth muscle, the clitoral corpus cavernosum and the vagina, arginase-2 plays a role in both male and female sexual arousal.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2391
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human