Antibodies
Anti-ARG2 Antibody-Oligo Conjugate
SKU: aoc1234
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ARG2 Antibody-IF1
Antibody Target
- Target
- Arginase-2, mitochondrial
- UniProt Number
- P78540
- Target Description
- May play a role in the regulation of extra-urea cycle arginine metabolism and also in down-regulation of nitric oxide synthesis. Extrahepatic arginase functions to regulate L-arginine bioavailability to nitric oxid synthase (NOS). Arginine metabolism is a critical regulator of innate and adaptive immune responses. Seems to be involved in negative regulation of the survival capacity of activated CD4(+) and CD8(+) T cells (PubMed:27745970). May suppress inflammation-related signaling in asthmatic airway epithelium (PubMed:27214549). May contribute to the immune evasion of H.pylori by restricting M1 macrophage activation and polyamine metabolism (By similarity). In fetal dendritic cells may play a role in promoting immune suppression and T cell TNF-alpha production during gestation (PubMed:28614294). Regulates RPS6KB1 signaling, which promotes endothelial cell senescence and inflammation and implicates NOS3/eNOS dysfunction (PubMed:22928666). Can inhibit endothelial autophagy independently of its enzymatic activity implicating mTORC2 signaling (PubMed:25484082). Involved in vascular smooth muscle cell senescence and apoptosis independently of its enzymatic activity (PubMed:23832324). Since NOS is found in the penile corpus cavernosum smooth muscle, the clitoral corpus cavernosum and the vagina, arginase-2 plays a role in both male and female sexual arousal (PubMed:12859189)..
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2391
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human