Antibodies
Anti-Argonaute 2 Antibody-Oligo Conjugate (ARC0189)
SKU: aoc1236
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Argonaute 2 Antibody (ARC0189)-IF1
Antibody Target
- Target
- Protein argonaute-2
- UniProt Number
- Q9UKV8
- Target Description
- Required for RNA-mediated gene silencing (RNAi) by the RNA-induced silencing complex (RISC). The 'minimal RISC' appears to include AGO2 bound to a short guide RNA such as a microRNA (miRNA) or short interfering RNA (siRNA). These guide RNAs direct RISC to complementary mRNAs that are targets for RISC-mediated gene silencing. The precise mechanism of gene silencing depends on the degree of complementarity between the miRNA or siRNA and its target. Binding of RISC to a perfectly complementary mRNA generally results in silencing due to endonucleolytic cleavage of the mRNA specifically by AGO2. Binding of RISC to a partially complementary mRNA results in silencing through inhibition of translation, and this is independent of endonuclease activity. May inhibit translation initiation by binding to the 7-methylguanosine cap, thereby preventing the recruitment of the translation initiation factor eIF4-E. May also inhibit translation initiation via interaction with EIF6, which itself binds to the 60S ribosomal subunit and prevents its association with the 40S ribosomal subunit. The inhibition of translational initiation leads to the accumulation of the affected mRNA in cytoplasmic processing bodies (P-bodies), where mRNA degradation may subsequently occur. In some cases RISC-mediated translational repression is also observed for miRNAs that perfectly match the 3' untranslated region (3'-UTR). Can also up-regulate the translation of specific mRNAs under certain growth conditions. Binds to the AU element of the 3'-UTR of the TNF (TNF-alpha) mRNA and up-regulates translation under conditions of serum starvation. Also required for transcriptional gene silencing (TGS), in which short RNAs known as antigene RNAs or agRNAs direct the transcriptional repression of complementary promoter regions..; FUNCTION: (Microbial infection) Upon Sars-CoV-2 infection, associates with viral miRNA-like small RNA, CoV2-miR-O7a, and may repress mRNAs, such as BATF2, to evade the IFN response..
- Molecular Weight
- 97kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0189
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat