Antibodies
Anti-Aromatase Antibody-Oligo Conjugate
SKU: aoc1241
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Aromatase Antibody-IF1
Antibody Target
- Target
- Aromatase
- UniProt Number
- P11511
- Target Description
- A cytochrome P450 monooxygenase that catalyzes the conversion of C19 androgens, androst-4-ene-3,17-dione (androstenedione) and testosterone to the C18 estrogens, estrone and estradiol, respectively (PubMed:27702664, PubMed:2848247). Catalyzes three successive oxidations of C19 androgens: two conventional oxidations at C19 yielding 19-hydroxy and 19-oxo/19-aldehyde derivatives, followed by a third oxidative aromatization step that involves C1-beta hydrogen abstraction combined with cleavage of the C10-C19 bond to yield a phenolic A ring and formic acid (PubMed:20385561). Alternatively, the third oxidative reaction yields a 19-norsteroid and formic acid. Converts dihydrotestosterone to delta1,10-dehydro 19-nordihydrotestosterone and may play a role in homeostasis of this potent androgen (PubMed:22773874). Also displays 2-hydroxylase activity toward estrone (PubMed:22773874). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:20385561, PubMed:22773874)..
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0635
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat