Antibodies
Anti-ARP3 Antibody-Oligo Conjugate
SKU: aoc1243
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ARP3 Antibody-IF1
Antibody Target
- Target
- Actin-related protein 3
- UniProt Number
- P61158
- Target Description
- ATP-binding component of the Arp2/3 complex, a multiprotein complex that mediates actin polymerization upon stimulation by nucleation-promoting factor (NPF) (PubMed:9000076). The Arp2/3 complex mediates the formation of branched actin networks in the cytoplasm, providing the force for cell motility (PubMed:9000076). Seems to contact the pointed end of the daughter actin filament (PubMed:9000076). In podocytes, required for the formation of lamellipodia downstream of AVIL and PLCE1 regulation (PubMed:29058690). In addition to its role in the cytoplasmic cytoskeleton, the Arp2/3 complex also promotes actin polymerization in the nucleus, thereby regulating gene transcription and repair of damaged DNA (PubMed:17220302, PubMed:29925947). The Arp2/3 complex promotes homologous recombination (HR) repair in response to DNA damage by promoting nuclear actin polymerization, leading to drive motility of double-strand breaks (DSBs) (PubMed:29925947). Plays a role in ciliogenesis (PubMed:20393563)..
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1067
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat