Antibodies
Anti-ARP3 Antibody-Oligo Conjugate
SKU: aoc1243
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ARP3 Antibody-IF1
Antibody Target
- Target
- Actin-related protein 3
- UniProt Number
- P61158
- Target Description
- ATP-binding component of the Arp2/3 complex, a multiprotein complex that mediates actin polymerization upon stimulation by nucleation-promoting factor (NPF). The Arp2/3 complex mediates the formation of branched actin networks in the cytoplasm, providing the force for cell motility. Seems to contact the pointed end of the daughter actin filament. In podocytes, required for the formation of lamellipodia downstream of AVIL and PLCE1 regulation. In addition to its role in the cytoplasmic cytoskeleton, the Arp2/3 complex also promotes actin polymerization in the nucleus, thereby regulating gene transcription and repair of damaged DNA. The Arp2/3 complex promotes homologous recombination (HR) repair in response to DNA damage by promoting nuclear actin polymerization, leading to drive motility of double-strand breaks (DSBs). Plays a role in ciliogenesis.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1067
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat