Antibodies
Anti-ARTS1 Antibody-Oligo Conjugate
SKU: aoc1246
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ARTS1 Antibody-IF1
Antibody Target
- Target
- Endoplasmic reticulum aminopeptidase 1
- UniProt Number
- Q9NZ08
- Target Description
- Aminopeptidase that plays a central role in peptide trimming, a step required for the generation of most HLA class I-binding peptides. Peptide trimming is essential to customize longer precursor peptides to fit them to the correct length required for presentation on MHC class I molecules. Strongly prefers substrates 9-16 residues long. Rapidly degrades 13-mer to a 9-mer and then stops. Preferentially hydrolyzes the residue Leu and peptides with a hydrophobic C-terminus, while it has weak activity toward peptides with charged C-terminus. May play a role in the inactivation of peptide hormones. May be involved in the regulation of blood pressure through the inactivation of angiotensin II and/or the generation of bradykinin in the kidney.
- Molecular Weight
- 107kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2120
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat