Antibodies
Anti-ASC Antibody-Oligo Conjugate
SKU: aoc1247
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ASC Antibody-IF1
Antibody Target
- Target
- Apoptosis-associated speck-like protein containing a CARD
- UniProt Number
- Q9ULZ3
- Target Description
- Functions as a key mediator in apoptosis and inflammation (PubMed:11103777, PubMed:12646168, PubMed:15030775, PubMed:17349957, PubMed:17599095, PubMed:19158675, PubMed:19158676, PubMed:19234215, PubMed:19494289, PubMed:21487011, PubMed:24630722, PubMed:25847972, PubMed:30674671, PubMed:34678144, PubMed:36050480). Promotes caspase-mediated apoptosis involving predominantly caspase-8 and also caspase-9 in a probable cell type-specific manner (PubMed:11103777, PubMed:12646168). Involved in activation of the mitochondrial apoptotic pathway, promotes caspase-8-dependent proteolytic maturation of BID independently of FADD in certain cell types and also mediates mitochondrial translocation of BAX and activates BAX-dependent apoptosis coupled to activation of caspase-9, -2 and -3 (PubMed:14730312, PubMed:16964285). Involved in innate immune response by acting as an integral adapter in the assembly of various inflammasomes (NLRP1, NLRP2, NLRP3, NLRP6, AIM2 and probably IFI16) which recruit and activate caspase-1 leading to processing and secretion of pro-inflammatory cytokines (PubMed:15030775, PubMed:16982856, PubMed:17349957, PubMed:17599095, PubMed:19158675, PubMed:19158676, PubMed:19234215, PubMed:21487011, PubMed:23530044, PubMed:24630722, PubMed:25847972, PubMed:29440442, PubMed:30674671, PubMed:33980849, PubMed:34678144, PubMed:34706239). Caspase-1-dependent inflammation leads to macrophage pyroptosis, a form of cell death (PubMed:24630722). The function as activating adapter in different types of inflammasomes is mediated by the pyrin and CARD domains and their homotypic interactions (PubMed:14499617, PubMed:19234215, PubMed:24630722). Clustered PYCARD nucleates the formation of caspase-1 filaments through the interaction of their respective CARD domains, acting as a platform for of caspase-1 polymerization (PubMed:24630722). In the NLRP1 and NLRC4 inflammasomes seems not be required but facilitates the processing of procaspase-1 (PubMed:17349957). In cooperation with NOD2 involved in an inflammasome activated by bacterial muramyl dipeptide leading to caspase-1 activation (PubMed:16964285). May be involved in RIGI-triggered pro-inflammatory responses and inflammasome activation (PubMed:19915568). In collaboration with AIM2 which detects cytosolic double-stranded DNA may also be involved in a caspase-1-independent cell death that involves caspase-8 (PubMed:19158675, PubMed:19158676). In adaptive immunity may be involved in maturation of dendritic cells to stimulate T-cell immunity and in cytoskeletal rearrangements coupled to chemotaxis and antigen uptake may be involved in post-transcriptional regulation of the guanine nucleotide exchange factor DOCK2; the latter function is proposed to involve the nuclear form (PubMed:22732093). Also involved in transcriptional activation of cytokines and chemokines independent of the inflammasome; this function may involve AP-1, NF-kappa-B, MAPK and caspase-8 signaling pathways (PubMed:12486103, PubMed:16585594). For regulation of NF-kappa-B activating and inhibiting functions have been reported (PubMed:12486103). Modulates NF-kappa-B induction at the level of the IKK complex by inhibiting kinase activity of CHUK and IKBK (PubMed:12486103, PubMed:16585594). Proposed to compete with RIPK2 for association with CASP1 thereby down-regulating CASP1-mediated RIPK2-dependent NF-kappa-B activation and activating interleukin-1 beta processing (PubMed:16585594). Modulates host resistance to DNA virus infection, probably by inducing the cleavage of and inactivating CGAS in presence of cytoplasmic double-stranded DNA (PubMed:28314590)..; FUNCTION: [Isoform 2]: May have a regulating effect on the function as inflammasome adapter..; FUNCTION: [Isoform 3]: Seems to inhibit inflammasome-mediated maturation of interleukin-1 beta..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54741
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat