Antibodies

Anti-ASC Antibody-Oligo Conjugate

SKU: aoc1247

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ASC Antibody-IF1

Antibody Target

Target
Apoptosis-associated speck-like protein containing a CARD
UniProt Number
Q9ULZ3
Target Description
Functions as a key mediator in apoptosis and inflammation. Promotes caspase-mediated apoptosis involving predominantly caspase-8 and also caspase-9 in a probable cell type-specific manner. Involved in activation of the mitochondrial apoptotic pathway, promotes caspase-8-dependent proteolytic maturation of BID independently of FADD in certain cell types and also mediates mitochondrial translocation of BAX and activates BAX-dependent apoptosis coupled to activation of caspase-9, -2 and -3. Involved in innate immune response by acting as an integral adapter in the assembly of various inflammasomes (NLRP1, NLRP2, NLRP3, NLRP6, AIM2 and probably IFI16) which recruit and activate caspase-1 leading to processing and secretion of pro-inflammatory cytokines. Caspase-1-dependent inflammation leads to macrophage pyroptosis, a form of cell death. The function as activating adapter in different types of inflammasomes is mediated by the pyrin and CARD domains and their homotypic interactions. Clustered PYCARD nucleates the formation of caspase-1 filaments through the interaction of their respective CARD domains, acting as a platform for of caspase-1 polymerization. In the NLRP1 and NLRC4 inflammasomes seems not be required but facilitates the processing of procaspase-1. In cooperation with NOD2 involved in an inflammasome activated by bacterial muramyl dipeptide leading to caspase-1 activation. May be involved in RIGI-triggered pro-inflammatory responses and inflammasome activation. In collaboration with AIM2 which detects cytosolic double-stranded DNA may also be involved in a caspase-1-independent cell death that involves caspase-8. In adaptive immunity may be involved in maturation of dendritic cells to stimulate T-cell immunity and in cytoskeletal rearrangements coupled to chemotaxis and antigen uptake may be involved in post-transcriptional regulation of the guanine nucleotide exchange factor DOCK2; the latter function is proposed to involve the nuclear form. Also involved in transcriptional activation of cytokines and chemokines independent of the inflammasome; this function may involve AP-1, NF-kappa-B, MAPK and caspase-8 signaling pathways. For regulation of NF-kappa-B activating and inhibiting functions have been reported. Modulates NF-kappa-B induction at the level of the IKK complex by inhibiting kinase activity of CHUK and IKBK. Proposed to compete with RIPK2 for association with CASP1 thereby down-regulating CASP1-mediated RIPK2-dependent NF-kappa-B activation and activating interleukin-1 beta processing. Modulates host resistance to DNA virus infection, probably by inducing the cleavage of and inactivating CGAS in presence of cytoplasmic double-stranded DNA.; FUNCTION: [Isoform 2]: May have a regulating effect on the function as inflammasome adapter.; FUNCTION: [Isoform 3]: Seems to inhibit inflammasome-mediated maturation of interleukin-1 beta.
Molecular Weight
22kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC54741
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat