Antibodies
Anti-ASCT2 Antibody-Oligo Conjugate
SKU: aoc1250
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ASCT2 Antibody-IF1
Antibody Target
- Target
- Neutral amino acid transporter B
- UniProt Number
- Q15758
- Target Description
- Sodium-coupled antiporter of neutral amino acids. In a tri-substrate transport cycle, exchanges neutral amino acids between the extracellular and intracellular compartments, coupled to the inward cotransport of at least one sodium ion (PubMed:17094966, PubMed:23756778, PubMed:26492990, PubMed:29872227, PubMed:34741534, PubMed:8702519). The preferred substrate is the essential amino acid L-glutamine, a precursor for biosynthesis of proteins, nucleotides and amine sugars as well as an alternative fuel for mitochondrial oxidative phosphorylation. Exchanges L-glutamine with other neutral amino acids such as L-serine, L-threonine and L-asparagine in a bidirectional way. Provides L-glutamine to proliferating stem and activated cells driving the metabolic switch toward cell differentiation (PubMed:23756778, PubMed:24953180). The transport cycle is usually pH-independent, with the exception of L-glutamate. Transports extracellular L-glutamate coupled to the cotransport of one proton and one sodium ion in exchange for intracellular L-glutamine counter-ion. May provide for L-glutamate uptake in glial cells regulating glutamine/glutamate cycle in the nervous system (PubMed:32733894). Can transport D-amino acids. Mediates D-serine release from the retinal glia potentially affecting NMDA receptor function in retinal neurons (PubMed:17094966). Displays sodium- and amino acid-dependent but uncoupled channel-like anion conductance with a preference SCN(-) >> NO3(-) > I(-) > Cl(-) (By similarity). Through binding of the fusogenic protein syncytin-1/ERVW-1 may mediate trophoblasts syncytialization, the spontaneous fusion of their plasma membranes, an essential process in placental development (PubMed:10708449, PubMed:23492904)..; FUNCTION: (Microbial infection) Acts as a cell surface receptor for Feline endogenous virus RD114..; FUNCTION: (Microbial infection) Acts as a cell surface receptor for Baboon M7 endogenous virus..; FUNCTION: (Microbial infection) Acts as a cell surface receptor for type D simian retroviruses..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59409
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human