Antibodies
Anti-ASCT2 Antibody-Oligo Conjugate
SKU: aoc1250
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ASCT2 Antibody-IF1
Antibody Target
- Target
- Neutral amino acid transporter B
- UniProt Number
- Q15758
- Target Description
- Sodium-coupled antiporter of neutral amino acids. In a tri-substrate transport cycle, exchanges neutral amino acids between the extracellular and intracellular compartments, coupled to the inward cotransport of at least one sodium ion. The preferred substrate is the essential amino acid L-glutamine, a precursor for biosynthesis of proteins, nucleotides and amine sugars as well as an alternative fuel for mitochondrial oxidative phosphorylation. Exchanges L-glutamine with other neutral amino acids such as L-serine, L-threonine and L-asparagine in a bidirectional way. Provides L-glutamine to proliferating stem and activated cells driving the metabolic switch toward cell differentiation. The transport cycle is usually pH-independent, with the exception of L-glutamate. Transports extracellular L-glutamate coupled to the cotransport of one proton and one sodium ion in exchange for intracellular L-glutamine counter-ion. May provide for L-glutamate uptake in glial cells regulating glutamine/glutamate cycle in the nervous system. Can transport D-amino acids. Mediates D-serine release from the retinal glia potentially affecting NMDA receptor function in retinal neurons. Displays sodium- and amino acid-dependent but uncoupled channel-like anion conductance with a preference SCN(-) >> NO3(-) > I(-) > Cl(-). Through binding of the fusogenic protein syncytin-1/ERVW-1 may mediate trophoblasts syncytialization, the spontaneous fusion of their plasma membranes, an essential process in placental development.; FUNCTION: (Microbial infection) Acts as a cell surface receptor for Feline endogenous virus RD114.; FUNCTION: (Microbial infection) Acts as a cell surface receptor for Baboon M7 endogenous virus.; FUNCTION: (Microbial infection) Acts as a cell surface receptor for type D simian retroviruses.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59409
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human