Antibodies
Anti-ASH2L Antibody-Oligo Conjugate
SKU: aoc1252
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ASH2L Antibody-IF1
Antibody Target
- Target
- Set1/Ash2 histone methyltransferase complex subunit ASH2
- UniProt Number
- Q9UBL3
- Target Description
- Transcriptional regulator. Component or associated component of some histone methyltransferase complexes which regulates transcription through recruitment of those complexes to gene promoters. Component of the Set1/Ash2 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3, but not if the neighboring 'Lys-9' residue is already methylated. As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3. May play a role in hematopoiesis. In association with RBBP5 and WDR5, stimulates the histone methyltransferase activities of KMT2A, KMT2B, KMT2C, KMT2D, SETD1A and SETD1B.
- Molecular Weight
- 69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC0326
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat