Antibodies

Anti-ASM Antibody-Oligo Conjugate

SKU: aoc1253

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ASM Antibody-IF1

Antibody Target

Target
Sphingomyelin phosphodiesterase
UniProt Number
P17405
Target Description
Converts sphingomyelin to ceramide. Exists as two enzymatic forms that arise from alternative trafficking of a single protein precursor, one that is targeted to the endolysosomal compartment, whereas the other is released extracellularly. However, in response to various forms of stress, lysosomal exocytosis may represent a major source of the secretory form.; FUNCTION: In the lysosomes, converts sphingomyelin to ceramide. Plays an important role in the export of cholesterol from the intraendolysosomal membranes. Also has phospholipase C activities toward 1,2-diacylglycerolphosphocholine and 1,2-diacylglycerolphosphoglycerol. Modulates stress-induced apoptosis through the production of ceramide.; FUNCTION: When secreted, modulates cell signaling with its ability to reorganize the plasma membrane by converting sphingomyelin to ceramide. Secreted form is increased in response to stress and inflammatory mediators such as IL1B, IFNG or TNF as well as upon infection with bacteria and viruses. Produces the release of ceramide in the outer leaflet of the plasma membrane playing a central role in host defense. Ceramide reorganizes these rafts into larger signaling platforms that are required to internalize P.aeruginosa, induce apoptosis and regulate the cytokine response in infected cells. In wounded cells, the lysosomal form is released extracellularly in the presence of Ca(2+) and promotes endocytosis and plasma membrane repair.; FUNCTION: [Sphingomyelin phosphodiesterase, processed form]: This form is generated following cleavage by CASP7 in the extracellular milieu in response to bacterial infection. It shows increased ability to convert sphingomyelin to ceramide and promotes plasma membrane repair. Plasma membrane repair by ceramide counteracts the action of gasdermin-D (GSDMD) perforin (PRF1) pores that are formed in response to bacterial infection.; FUNCTION: (Microbial infection) Secretion is activated by bacteria such as P.aeruginosa, N.gonorrhoeae and others, this activation results in the release of ceramide in the outer leaflet of the plasma membrane which facilitates the infection.; FUNCTION: (Microbial infection) Secretion is activated by human coronaviruses SARS-CoV and SARS-CoV-2 as well as Zaire ebolavirus, this activation results in the release of ceramide in the outer leaflet of the plasma membrane which facilitates the infection.; FUNCTION: [Isoform 2]: Lacks residues that bind the cofactor Zn(2+) and has no enzyme activity.; FUNCTION: [Isoform 3]: Lacks residues that bind the cofactor Zn(2+) and has no enzyme activity.
Molecular Weight
70 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-FIHCELISA
Clone
ARC62108
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanRat