Antibodies
Anti-ATF1 Antibody-Oligo Conjugate
SKU: aoc1261
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATF1 Antibody-IF1
Antibody Target
- Target
- Cyclic AMP-dependent transcription factor ATF-1
- UniProt Number
- P18846
- Target Description
- This protein binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), a sequence present in many viral and cellular promoters. Binds to the Tax-responsive element (TRE) of HTLV-I. Mediates PKA-induced stimulation of CRE-reporter genes. Represses the expression of FTH1 and other antioxidant detoxification genes. Triggers cell proliferation and transformation.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC73543
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant fusion protein containing a sequence corresponding to amino acids 1-89 of human ATF1 (NP_005162.1).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat