Antibodies
Anti-ATF2 Antibody-Oligo Conjugate
SKU: aoc1262
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATF2 Antibody-IF1
Antibody Target
- Target
- Cyclic AMP-dependent transcription factor ATF-2
- UniProt Number
- P15336
- Target Description
- Transcriptional activator which regulates the transcription of various genes, including those involved in anti-apoptosis, cell growth, and DNA damage response. Dependent on its binding partner, binds to CRE (cAMP response element) consensus sequences (5'-TGACGTCA-3') or to AP-1 (activator protein 1) consensus sequences (5'-TGACTCA-3'). In the nucleus, contributes to global transcription and the DNA damage response, in addition to specific transcriptional activities that are related to cell development, proliferation and death. In the cytoplasm, interacts with and perturbs HK1- and VDAC1-containing complexes at the mitochondrial outer membrane, thereby impairing mitochondrial membrane potential, inducing mitochondrial leakage and promoting cell death. The phosphorylated form (mediated by ATM) plays a role in the DNA damage response and is involved in the ionizing radiation (IR)-induced S phase checkpoint control and in the recruitment of the MRN complex into the IR-induced foci (IRIF). Exhibits histone acetyltransferase (HAT) activity which specifically acetylates histones H2B and H4 in vitro (PubMed:10821277). In concert with CUL3 and RBX1, promotes the degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. Can elicit oncogenic or tumor suppressor activities depending on the tissue or cell type..
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC55522
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat