Antibodies
Anti-ATF5 Antibody-Oligo Conjugate
SKU: aoc1263
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATF5 Antibody-IF1
Antibody Target
- Target
- Cyclic AMP-dependent transcription factor ATF-5
- UniProt Number
- Q9Y2D1
- Target Description
- Transcription factor that either stimulates or represses gene transcription through binding of different DNA regulatory elements such as cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3'), ATF5-specific response element (ARE) (consensus: 5'-C[CT]TCT[CT]CCTT[AT]-3') but also the amino acid response element (AARE), present in many viral and cellular promoters. Critically involved, often in a cell type-dependent manner, in cell survival, proliferation, and differentiation. Its transcriptional activity is enhanced by CCND3 and slightly inhibited by CDK4. Important regulator of the cerebral cortex formation, functions in cerebral cortical neuroprogenitor cells to maintain proliferation and to block differentiation into neurons. Must be down-regulated in order for such cells to exit the cycle and differentiate. Participates in the pathways by which SHH promotes cerebellar granule neuron progenitor cells proliferation. Critical for survival of mature olfactory sensory neurons (OSN), directs expression of OSN-specific genes. May be involved in osteogenic differentiation. Promotes cell proliferation and survival by inducing the expression of EGR1 sinergistically with ELK1. Once acetylated by EP300, binds to ARE sequences on target genes promoters, such as BCL2 and EGR1. Plays an anti-apoptotic role through the transcriptional regulation of BCL2, this function seems to be cell type-dependent. Cooperates with NR1I3/CAR in the transcriptional activation of CYP2B6 in liver. In hepatic cells, represses CRE-dependent transcription and inhibits proliferation by blocking at G2/M phase. May act as a negative regulator of IL1B transduction pathway in liver. Upon IL1B stimulus, cooperates with NLK to activate the transactivation activity of C/EBP subfamily members. Besides its function of transcription factor, acts as a cofactor of CEBPB to activate CEBPA and promote adipocyte differentiation. Regulates centrosome dynamics in a cell-cycle- and centriole-age-dependent manner. Forms 9-foci symmetrical ring scaffold around the mother centriole to control centrosome function and the interaction between centrioles and pericentriolar material.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2043
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat