Antibodies
Anti-Atg12 | ATG12 Antibody-Oligo Conjugate (ARC2663)
SKU: aoc1267
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Atg12 | ATG12 Antibody (ARC2663)-IF1
Antibody Target
- Target
- Ubiquitin-like protein ATG12
- UniProt Number
- O94817
- Target Description
- Ubiquitin-like protein involved in autophagy vesicles formation. Conjugation with ATG5 through a ubiquitin-like conjugating system involving also ATG7 as an E1-like activating enzyme and ATG10 as an E2-like conjugating enzyme, is essential for its function. The ATG12-ATG5 conjugate acts as an E3-like enzyme which is required for lipidation of ATG8 family proteins and their association to the vesicle membranes. As part of the ATG8 conjugation system with ATG5 and ATG16L1, required for recruitment of LRRK2 to stressed lysosomes and induction of LRRK2 kinase activity in response to lysosomal stress (By similarity)..; FUNCTION: (Microbial infection) May act as a proviral factor. In association with ATG5, negatively regulates the innate antiviral immune response by impairing the type I IFN production pathway upon vesicular stomatitis virus (VSV) infection (PubMed:17709747). Required for the translation of incoming hepatitis C virus (HCV) RNA and, thereby, for the initiation of HCV replication, but not required once infection is established (PubMed:19666601)..
- Molecular Weight
- 15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC2663
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse