Antibodies
Anti-ATG3 Antibody-Oligo Conjugate
SKU: aoc1269
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATG3 Antibody-IF1
Antibody Target
- Target
- Ubiquitin-like-conjugating enzyme ATG3
- UniProt Number
- Q9NT62
- Target Description
- E2 conjugating enzyme that catalyzes the covalent conjugation of the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A) to the amino group of phosphatidylethanolamine (PE)-containing lipids in the membrane resulting in membrane-bound ATG8-like proteins which is one of the key steps in the development of autophagic isolation membranes during autophagosome formation (PubMed:24191030, PubMed:33446636, PubMed:37252361). Cycles back and forth between binding to ATG7 for loading with the ATG8-like proteins and binding to E3 enzyme, composed of ATG12, ATG5 and ATG16L1 to promote ATG8-like proteins lipidation (PubMed:11825910, PubMed:12207896, PubMed:12890687, PubMed:16704426, PubMed:24186333). Also plays a role as a membrane curvature sensor that facilitates LC3/GABARAP lipidation by sensing local membrane stress associated with lipid-packing defects as occurs with high molar proportions of conical lipids or strident membrane curvature (By similarity). Interacts with negatively-charged membranes promoting membrane tethering and enhancing LC3/GABARAP lipidation (PubMed:29142222). Also acts as an autocatalytic E2-like enzyme by catalyzing the conjugation of ATG12 to itself in an ATG7-dependent manner, this complex thus formed, plays a role in mitochondrial homeostasis but not in autophagy (By similarity). ATG12-ATG3 conjugation promotes late endosome to lysosome trafficking and basal autophagosome maturation via its interaction with PDCD6IP (By similarity). ATG12-ATG3 conjugate is also formed upon viccina virus infection, leading to the disruption the cellular autophagy which is not necessary for vaccinia survival and proliferation (By similarity). Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway (By similarity)..
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0073
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat