Antibodies
Anti-ATG4B Antibody-Oligo Conjugate
SKU: aoc1270
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATG4B Antibody-IF1
Antibody Target
- Target
- Cysteine protease ATG4B
- UniProt Number
- Q9Y4P1
- Target Description
- Cysteine protease that plays a key role in autophagy by mediating both proteolytic activation and delipidation of ATG8 family proteins (PubMed:15169837, PubMed:15187094, PubMed:17347651, PubMed:19322194, PubMed:21177865, PubMed:22302004, PubMed:26378241, PubMed:27527864, PubMed:28633005, PubMed:28821708, PubMed:29232556, PubMed:30076329, PubMed:30443548, PubMed:30661429). Required for canonical autophagy (macroautophagy), non-canonical autophagy as well as for mitophagy (PubMed:33773106, PubMed:33909989). The protease activity is required for proteolytic activation of ATG8 family proteins: cleaves the C-terminal amino acid of ATG8 proteins MAP1LC3A, MAP1LC3B, MAP1LC3C, GABARAPL1, GABARAPL2 and GABARAP, to reveal a C-terminal glycine (PubMed:15169837, PubMed:15187094, PubMed:17347651, PubMed:19322194, PubMed:20818167, PubMed:21177865, PubMed:22302004, PubMed:27527864, PubMed:28287329, PubMed:28633005, PubMed:29458288, PubMed:30661429). Exposure of the glycine at the C-terminus is essential for ATG8 proteins conjugation to phosphatidylethanolamine (PE) and insertion to membranes, which is necessary for autophagy (PubMed:15169837, PubMed:15187094, PubMed:17347651, PubMed:19322194, PubMed:21177865, PubMed:22302004). Protease activity is also required to counteract formation of high-molecular weight conjugates of ATG8 proteins (ATG8ylation): acts as a deubiquitinating-like enzyme that removes ATG8 conjugated to other proteins, such as ATG3 (PubMed:31315929, PubMed:33773106). In addition to the protease activity, also mediates delipidation of ATG8 family proteins (PubMed:15187094, PubMed:19322194, PubMed:28633005, PubMed:29458288, PubMed:32686895, PubMed:33909989). Catalyzes delipidation of PE-conjugated forms of ATG8 proteins during macroautophagy (PubMed:15187094, PubMed:19322194, PubMed:29458288, PubMed:32686895, PubMed:33909989). Also involved in non-canonical autophagy, a parallel pathway involving conjugation of ATG8 proteins to single membranes at endolysosomal compartments, by catalyzing delipidation of ATG8 proteins conjugated to phosphatidylserine (PS) (PubMed:33909989). Compared to other members of the family (ATG4A, ATG4C or ATG4C), constitutes the major protein for proteolytic activation of ATG8 proteins, while it displays weaker delipidation activity than other ATG4 paralogs (PubMed:29458288, PubMed:30661429). Involved in phagophore growth during mitophagy independently of its protease activity and of ATG8 proteins: acts by regulating ATG9A trafficking to mitochondria and promoting phagophore-endoplasmic reticulum contacts during the lipid transfer phase of mitophagy (PubMed:33773106)..
- Molecular Weight
- 44kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC1264
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat