Antibodies
Anti-ATG7 Antibody-Oligo Conjugate
SKU: aoc1271
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATG7 Antibody-IF1
Antibody Target
- Target
- Ubiquitin-like modifier-activating enzyme ATG7
- UniProt Number
- O95352
- Target Description
- E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy. Activates ATG12 for its conjugation with ATG5 as well as the ATG8 family proteins for their conjugation with phosphatidylethanolamine. Both systems are needed for the ATG8 association to Cvt vesicles and autophagosomes membranes. Required for autophagic death induced by caspase-8 inhibition. Facilitates LC3-I lipidation with phosphatidylethanolamine to form LC3-II which is found on autophagosomal membranes. Required for mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Modulates p53/TP53 activity to regulate cell cycle and survival during metabolic stress. Also plays a key role in the maintenance of axonal homeostasis, the prevention of axonal degeneration, the maintenance of hematopoietic stem cells, the formation of Paneth cell granules, as well as in adipose differentiation. Plays a role in regulating the liver clock and glucose metabolism by mediating the autophagic degradation of CRY1 (clock repressor) in a time-dependent manner.
- Molecular Weight
- 78 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC0083
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat