Antibodies

Anti-ATM Antibody-Oligo Conjugate

SKU: aoc1272

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ATM Antibody-IF1

Antibody Target

Target
Serine-protein kinase ATM
UniProt Number
Q13315
Target Description
Serine/threonine protein kinase which activates checkpoint signaling upon double strand breaks (DSBs), apoptosis and genotoxic stresses such as ionizing ultraviolet A light (UVA), thereby acting as a DNA damage sensor (PubMed:10550055, PubMed:10839545, PubMed:10910365, PubMed:12556884, PubMed:14871926, PubMed:15064416, PubMed:15448695, PubMed:15456891, PubMed:15790808, PubMed:15916964, PubMed:17923702, PubMed:21757780, PubMed:24534091, PubMed:35076389, PubMed:9733514). Recognizes the substrate consensus sequence [ST]-Q (PubMed:10550055, PubMed:10839545, PubMed:10910365, PubMed:12556884, PubMed:14871926, PubMed:15448695, PubMed:15456891, PubMed:15916964, PubMed:17923702, PubMed:24534091, PubMed:9733514). Phosphorylates 'Ser-139' of histone variant H2AX at double strand breaks (DSBs), thereby regulating DNA damage response mechanism (By similarity). Also plays a role in pre-B cell allelic exclusion, a process leading to expression of a single immunoglobulin heavy chain allele to enforce clonality and monospecific recognition by the B-cell antigen receptor (BCR) expressed on individual B-lymphocytes. After the introduction of DNA breaks by the RAG complex on one immunoglobulin allele, acts by mediating a repositioning of the second allele to pericentromeric heterochromatin, preventing accessibility to the RAG complex and recombination of the second allele. Also involved in signal transduction and cell cycle control. May function as a tumor suppressor. Necessary for activation of ABL1 and SAPK. Phosphorylates DYRK2, CHEK2, p53/TP53, FBXW7, FANCD2, NFKBIA, BRCA1, CREBBP/CBP, RBBP8/CTIP, FBXO46, MRE11, nibrin (NBN), RAD50, RAD17, PELI1, TERF1, UFL1, RAD9, UBQLN4 and DCLRE1C (PubMed:10550055, PubMed:10766245, PubMed:10802669, PubMed:10839545, PubMed:10910365, PubMed:10973490, PubMed:11375976, PubMed:12086603, PubMed:15456891, PubMed:19965871, PubMed:21757780, PubMed:24534091, PubMed:26240375, PubMed:26774286, PubMed:30171069, PubMed:30612738, PubMed:30886146, PubMed:30952868, PubMed:38128537, PubMed:9733515, PubMed:9843217). May play a role in vesicle and/or protein transport. Could play a role in T-cell development, gonad and neurological function. Plays a role in replication-dependent histone mRNA degradation. Binds DNA ends. Phosphorylation of DYRK2 in nucleus in response to genotoxic stress prevents its MDM2-mediated ubiquitination and subsequent proteasome degradation (PubMed:19965871). Phosphorylates ATF2 which stimulates its function in DNA damage response (PubMed:15916964). Phosphorylates ERCC6 which is essential for its chromatin remodeling activity at DNA double-strand breaks (PubMed:29203878). Phosphorylates TTC5/STRAP at 'Ser-203' in the cytoplasm in response to DNA damage, which promotes TTC5/STRAP nuclear localization (PubMed:15448695). Also involved in pexophagy by mediating phosphorylation of PEX5: translocated to peroxisomes in response to reactive oxygen species (ROS), and catalyzes phosphorylation of PEX5, promoting PEX5 ubiquitination and induction of pexophagy (PubMed:26344566)..
Molecular Weight
351kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0129
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouse