Antibodies
Anti-ATP2A2 Antibody-Oligo Conjugate
SKU: aoc1280
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATP2A2 Antibody-IF1
Antibody Target
- Target
- Sarcoplasmic/endoplasmic reticulum calcium ATPase 2
- UniProt Number
- P16615
- Target Description
- This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen (PubMed:12542527, PubMed:16402920). Involved in autophagy in response to starvation. Upon interaction with VMP1 and activation, controls ER-isolation membrane contacts for autophagosome formation (PubMed:28890335). Also modulates ER contacts with lipid droplets, mitochondria and endosomes (PubMed:28890335). In coordination with FLVCR2 mediates heme-stimulated switching from mitochondrial ATP synthesis to thermogenesis (By similarity)..; FUNCTION: [Isoform 2]: Involved in the regulation of the contraction/relaxation cycle. Acts as a regulator of TNFSF11-mediated Ca(2+) signaling pathways via its interaction with TMEM64 which is critical for the TNFSF11-induced CREB1 activation and mitochondrial ROS generation necessary for proper osteoclast generation. Association between TMEM64 and SERCA2 in the ER leads to cytosolic Ca(2+) spiking for activation of NFATC1 and production of mitochondrial ROS, thereby triggering Ca(2+) signaling cascades that promote osteoclast differentiation and activation..
- Molecular Weight
- 115 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0679
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat