Antibodies
Anti-ATP2A2 Antibody-Oligo Conjugate
SKU: aoc1280
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATP2A2 Antibody-IF1
Antibody Target
- Target
- Sarcoplasmic/endoplasmic reticulum calcium ATPase 2
- UniProt Number
- P16615
- Target Description
- This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen. Involved in autophagy in response to starvation. Upon interaction with VMP1 and activation, controls ER-isolation membrane contacts for autophagosome formation. Also modulates ER contacts with lipid droplets, mitochondria and endosomes. In coordination with FLVCR2 mediates heme-stimulated switching from mitochondrial ATP synthesis to thermogenesis.; FUNCTION: [Isoform 2]: Involved in the regulation of the contraction/relaxation cycle. Acts as a regulator of TNFSF11-mediated Ca(2+) signaling pathways via its interaction with TMEM64 which is critical for the TNFSF11-induced CREB1 activation and mitochondrial ROS generation necessary for proper osteoclast generation. Association between TMEM64 and SERCA2 in the ER leads to cytosolic Ca(2+) spiking for activation of NFATC1 and production of mitochondrial ROS, thereby triggering Ca(2+) signaling cascades that promote osteoclast differentiation and activation.
- Molecular Weight
- 115 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0679
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat