Antibodies
Anti-ATP4B Antibody-Oligo Conjugate
SKU: aoc1281
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATP4B Antibody-IF1
Antibody Target
- Target
- Potassium-transporting ATPase subunit beta
- UniProt Number
- P51164
- Target Description
- The beta subunit of the gastric H(+)/K(+) ATPase pump which transports H(+) ions in exchange for K(+) ions across the apical membrane of parietal cells. Plays a structural and regulatory role in the assembly and membrane targeting of a functionally active pump. Within a transport cycle, the transfer of a H(+) ion across the membrane is coupled to ATP hydrolysis and is associated with a transient phosphorylation of the alpha subunit that shifts the pump conformation from inward-facing (E1) to outward-facing state (E2). Interacts with the phosphorylation domain of the alpha subunit and functions as a ratchet, stabilizing the lumenal-open E2 conformation and preventing the reverse reaction of the transport cycle.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2461
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat