Antibodies
Anti-ATP6AP1 Antibody-Oligo Conjugate
SKU: aoc1286
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATP6AP1 Antibody-IF1
Antibody Target
- Target
- V-type proton ATPase subunit S1
- UniProt Number
- Q15904
- Target Description
- Accessory subunit of the proton-transporting vacuolar (V)-ATPase protein pump, which is required for luminal acidification of secretory vesicles (PubMed:33065002). Guides the V-type ATPase into specialized subcellular compartments, such as neuroendocrine regulated secretory vesicles or the ruffled border of the osteoclast, thereby regulating its activity (PubMed:27231034). Involved in membrane trafficking and Ca(2+)-dependent membrane fusion (PubMed:27231034). May play a role in the assembly of the V-type ATPase complex (Probable). In aerobic conditions, involved in intracellular iron homeostasis, thus triggering the activity of Fe(2+) prolyl hydroxylase (PHD) enzymes, and leading to HIF1A hydroxylation and subsequent proteasomal degradation (PubMed:28296633). In islets of Langerhans cells, may regulate the acidification of dense-core secretory granules (By similarity)..
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57179
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse