Antibodies

Anti-ATR Antibody-Oligo Conjugate (ARC53816)

SKU: aoc1293

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-ATR Antibody (ARC53816)-IF1

Antibody Target

Target
Serine/threonine-protein kinase ATR
UniProt Number
Q13535
Target Description
Serine/threonine protein kinase which activates checkpoint signaling upon genotoxic stresses such as ionizing radiation (IR), ultraviolet light (UV), or DNA replication stalling, thereby acting as a DNA damage sensor (PubMed:10597277, PubMed:10608806, PubMed:10859164, PubMed:11721054, PubMed:12791985, PubMed:12814551, PubMed:14657349, PubMed:14729973, PubMed:14742437, PubMed:15210935, PubMed:15496423, PubMed:16260606, PubMed:21144835, PubMed:21777809, PubMed:23273981, PubMed:25083873, PubMed:27723717, PubMed:27723720, PubMed:30139873, PubMed:33848395, PubMed:37788673, PubMed:37832547, PubMed:9427750, PubMed:9636169). Recognizes the substrate consensus sequence [ST]-Q (PubMed:10597277, PubMed:10608806, PubMed:10859164, PubMed:11721054, PubMed:12791985, PubMed:12814551, PubMed:14657349, PubMed:14729973, PubMed:14742437, PubMed:15210935, PubMed:15496423, PubMed:16260606, PubMed:21144835, PubMed:23273981, PubMed:27723717, PubMed:27723720, PubMed:33848395, PubMed:9427750, PubMed:9636169). Phosphorylates BRCA1, CHEK1, MCM2, RAD17, RBBP8, RPA2, SMC1 and p53/TP53, which collectively inhibit DNA replication and mitosis and promote DNA repair, recombination and apoptosis (PubMed:11114888, PubMed:11418864, PubMed:11865061, PubMed:21777809, PubMed:23273981, PubMed:25083873, PubMed:9925639). Phosphorylates 'Ser-139' of histone variant H2AX at sites of DNA damage, thereby regulating DNA damage response mechanism (PubMed:11673449). Required for FANCD2 ubiquitination (PubMed:15314022). Critical for maintenance of fragile site stability and efficient regulation of centrosome duplication (PubMed:12526805). Acts as a regulator of the S-G2 transition by restricting the activity of CDK1 during S-phase to prevent premature entry into G2 (PubMed:30139873). Acts as a regulator of the nuclear envelope integrity in response to DNA damage and stress (PubMed:25083873, PubMed:37788673, PubMed:37832547). Acts as a mechanical stress sensor at the nuclear envelope: relocalizes to the nuclear envelope in response to mechanical stress and mediates a checkpoint via phosphorylation of CHEK1 (PubMed:25083873). Also promotes nuclear envelope rupture in response to DNA damage by mediating phosphorylation of LMNA at 'Ser-282', leading to lamin disassembly (PubMed:37832547). Involved in the inflammatory response to genome instability and double-stranded DNA breaks: acts by localizing to micronuclei arising from genome instability and catalyzing phosphorylation of LMNA at 'Ser-395', priming LMNA for subsequent phosphorylation by CDK1 and micronuclei envelope rupture (PubMed:37788673). The rupture of micronuclear envelope triggers the cGAS-STING pathway thereby activating the type I interferon response and innate immunity (PubMed:37788673). Positively regulates the restart of stalled replication forks following activation by the KHDC3L-OOEP scaffold complex (By similarity)..
Molecular Weight
301kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC53816
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human