Antibodies
Anti-ATR Antibody-Oligo Conjugate (ARC53816)
SKU: aoc1293
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ATR Antibody (ARC53816)-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase ATR
- UniProt Number
- Q13535
- Target Description
- Serine/threonine protein kinase which activates checkpoint signaling upon genotoxic stresses such as ionizing radiation (IR), ultraviolet light (UV), or DNA replication stalling, thereby acting as a DNA damage sensor (PubMed:10597277, PubMed:10608806, PubMed:10859164, PubMed:11721054, PubMed:12791985, PubMed:12814551, PubMed:14657349, PubMed:14729973, PubMed:14742437, PubMed:15210935, PubMed:15496423, PubMed:16260606, PubMed:21144835, PubMed:21777809, PubMed:23273981, PubMed:25083873, PubMed:27723717, PubMed:27723720, PubMed:30139873, PubMed:33848395, PubMed:37788673, PubMed:37832547, PubMed:9427750, PubMed:9636169). Recognizes the substrate consensus sequence [ST]-Q (PubMed:10597277, PubMed:10608806, PubMed:10859164, PubMed:11721054, PubMed:12791985, PubMed:12814551, PubMed:14657349, PubMed:14729973, PubMed:14742437, PubMed:15210935, PubMed:15496423, PubMed:16260606, PubMed:21144835, PubMed:23273981, PubMed:27723717, PubMed:27723720, PubMed:33848395, PubMed:9427750, PubMed:9636169). Phosphorylates BRCA1, CHEK1, MCM2, RAD17, RBBP8, RPA2, SMC1 and p53/TP53, which collectively inhibit DNA replication and mitosis and promote DNA repair, recombination and apoptosis (PubMed:11114888, PubMed:11418864, PubMed:11865061, PubMed:21777809, PubMed:23273981, PubMed:25083873, PubMed:9925639). Phosphorylates 'Ser-139' of histone variant H2AX at sites of DNA damage, thereby regulating DNA damage response mechanism (PubMed:11673449). Required for FANCD2 ubiquitination (PubMed:15314022). Critical for maintenance of fragile site stability and efficient regulation of centrosome duplication (PubMed:12526805). Acts as a regulator of the S-G2 transition by restricting the activity of CDK1 during S-phase to prevent premature entry into G2 (PubMed:30139873). Acts as a regulator of the nuclear envelope integrity in response to DNA damage and stress (PubMed:25083873, PubMed:37788673, PubMed:37832547). Acts as a mechanical stress sensor at the nuclear envelope: relocalizes to the nuclear envelope in response to mechanical stress and mediates a checkpoint via phosphorylation of CHEK1 (PubMed:25083873). Also promotes nuclear envelope rupture in response to DNA damage by mediating phosphorylation of LMNA at 'Ser-282', leading to lamin disassembly (PubMed:37832547). Involved in the inflammatory response to genome instability and double-stranded DNA breaks: acts by localizing to micronuclei arising from genome instability and catalyzing phosphorylation of LMNA at 'Ser-395', priming LMNA for subsequent phosphorylation by CDK1 and micronuclei envelope rupture (PubMed:37788673). The rupture of micronuclear envelope triggers the cGAS-STING pathway thereby activating the type I interferon response and innate immunity (PubMed:37788673). Positively regulates the restart of stalled replication forks following activation by the KHDC3L-OOEP scaffold complex (By similarity)..
- Molecular Weight
- 301kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC53816
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human