Antibodies
Anti-AUH Antibody-Oligo Conjugate
SKU: aoc1295
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-AUH Antibody-IF1
Antibody Target
- Target
- Methylglutaconyl-CoA hydratase, mitochondrial
- UniProt Number
- Q13825
- Target Description
- Catalyzes the fifth step in the leucine degradation pathway, the reversible hydration of 3-methylglutaconyl-CoA (3-MG-CoA) to 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). Can catalyze the reverse reaction but at a much lower rate in vitro. HMG-CoA is then quickly degraded by another enzyme (such as HMG-CoA lyase) to give acetyl-CoA and acetoacetate. Uses other substrates such as (2E)-glutaconyl-CoA efficiently in vitro, and to a lesser extent 3-methylcrotonyl-CoA (3-methyl-(2E)-butenoyl-CoA), crotonyl-CoA ((2E)-butenoyl-CoA) and 3-hydroxybutanoyl-CoA (the missing carboxylate reduces affinity to the active site). Originally it was identified as an RNA-binding protein as it binds to AU-rich elements (AREs) in vitro. AREs direct rapid RNA degradation and mRNA deadenylation. Might have itaconyl-CoA hydratase activity, converting itaconyl-CoA into citramalyl-CoA in the C5-dicarboxylate catabolism pathway. The C5-dicarboxylate catabolism pathway is required to detoxify itaconate, an antimicrobial metabolite and immunomodulator produced by macrophages during certain infections, that can act as a vitamin B12-poisoning metabolite.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC65584
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat