Antibodies
Anti-BACH1 Antibody-Oligo Conjugate
SKU: aoc1301
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-BACH1 Antibody-PLA1
Antibody Target
- Target
- Transcription regulator protein BACH1
- UniProt Number
- O14867
- Target Description
- Transcriptional regulator that acts as a repressor or activator, depending on the context. Binds to NF-E2 DNA binding sites. Plays important roles in coordinating transcription activation and repression by MAFK (By similarity). Together with MAF, represses the transcription of genes under the control of the NFE2L2 oxidative stress pathway (PubMed:24035498)..
- Molecular Weight
- 82kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBELISAChIP
- Clone
- ARC56290
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse