Antibodies
Anti-BAD Antibody-Oligo Conjugate
SKU: aoc1302
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAD Antibody-IF1
Antibody Target
- Target
- Bcl2-associated agonist of cell death
- UniProt Number
- Q92934
- Target Description
- Promotes cell death. Successfully competes for the binding to Bcl-X(L), Bcl-2 and Bcl-W, thereby affecting the level of heterodimerization of these proteins with BAX. Can reverse the death repressor activity of Bcl-X(L), but not that of Bcl-2. Appears to act as a link between growth factor receptor signaling and the apoptotic pathways.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0074
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat