Antibodies
Anti-BAF Antibody-Oligo Conjugate
SKU: aoc1303
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAF Antibody-IF1
Antibody Target
- Target
- Barrier-to-autointegration factor
- UniProt Number
- O75531
- Target Description
- Non-specific DNA-binding protein that plays key roles in mitotic nuclear reassembly, chromatin organization, DNA damage response, gene expression and intrinsic immunity against foreign DNA (PubMed:10908652, PubMed:11792822, PubMed:12163470, PubMed:18005698, PubMed:25991860, PubMed:28841419, PubMed:31796734, PubMed:32792394). Contains two non-specific double-stranded DNA (dsDNA)-binding sites which promote DNA cross-bridging (PubMed:9465049). Plays a key role in nuclear membrane reformation at the end of mitosis by driving formation of a single nucleus in a spindle-independent manner (PubMed:28841419). Transiently cross-bridges anaphase chromosomes via its ability to bridge distant DNA sites, leading to the formation of a dense chromatin network at the chromosome ensemble surface that limits membranes to the surface (PubMed:28841419). Also acts as a negative regulator of innate immune activation by restricting CGAS activity toward self-DNA upon acute loss of nuclear membrane integrity (PubMed:32792394). Outcompetes CGAS for DNA-binding, thereby preventing CGAS activation and subsequent damaging autoinflammatory responses (PubMed:32792394). Also involved in DNA damage response: interacts with PARP1 in response to oxidative stress, thereby inhibiting the ADP-ribosyltransferase activity of PARP1 (PubMed:31796734). Involved in the recognition of exogenous dsDNA in the cytosol: associates with exogenous dsDNA immediately after its appearance in the cytosol at endosome breakdown and is required to avoid autophagy (PubMed:25991860). In case of poxvirus infection, has an antiviral activity by blocking viral DNA replication (PubMed:18005698)..; FUNCTION: (Microbial infection) Exploited by retroviruses for inhibiting self-destructing autointegration of retroviral DNA, thereby promoting integration of viral DNA into the host chromosome (PubMed:11005805, PubMed:16680152, PubMed:9465049). EMD and BAF are cooperative cofactors of HIV-1 infection (PubMed:16680152). Association of EMD with the viral DNA requires the presence of BAF and viral integrase (PubMed:16680152). The association of viral DNA with chromatin requires the presence of BAF and EMD (PubMed:16680152)..
- Molecular Weight
- 10kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2085
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat