Antibodies
Anti-BAF Antibody-Oligo Conjugate
SKU: aoc1303
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAF Antibody-IF1
Antibody Target
- Target
- Barrier-to-autointegration factor
- UniProt Number
- O75531
- Target Description
- Non-specific DNA-binding protein that plays key roles in mitotic nuclear reassembly, chromatin organization, DNA damage response, gene expression and intrinsic immunity against foreign DNA. Contains two non-specific double-stranded DNA (dsDNA)-binding sites which promote DNA cross-bridging. Plays a key role in nuclear membrane reformation at the end of mitosis by driving formation of a single nucleus in a spindle-independent manner. Transiently cross-bridges anaphase chromosomes via its ability to bridge distant DNA sites, leading to the formation of a dense chromatin network at the chromosome ensemble surface that limits membranes to the surface. Also acts as a negative regulator of innate immune activation by restricting CGAS activity toward self-DNA upon acute loss of nuclear membrane integrity. Outcompetes CGAS for DNA-binding, thereby preventing CGAS activation and subsequent damaging autoinflammatory responses. Also involved in DNA damage response: interacts with PARP1 in response to oxidative stress, thereby inhibiting the ADP-ribosyltransferase activity of PARP1. Involved in the recognition of exogenous dsDNA in the cytosol: associates with exogenous dsDNA immediately after its appearance in the cytosol at endosome breakdown and is required to avoid autophagy. In case of poxvirus infection, has an antiviral activity by blocking viral DNA replication.; FUNCTION: (Microbial infection) Exploited by retroviruses for inhibiting self-destructing autointegration of retroviral DNA, thereby promoting integration of viral DNA into the host chromosome. EMD and BAF are cooperative cofactors of HIV-1 infection. Association of EMD with the viral DNA requires the presence of BAF and viral integrase. The association of viral DNA with chromatin requires the presence of BAF and EMD.
- Molecular Weight
- 10kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2085
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat