Antibodies
Anti-Bag1 Antibody-Oligo Conjugate
SKU: aoc1304
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Bag1 Antibody-IF1
Antibody Target
- Target
- BAG family molecular chaperone regulator 1
- UniProt Number
- Q99933
- Target Description
- Co-chaperone for HSP70 and HSC70 chaperone proteins. Acts as a nucleotide-exchange factor (NEF) promoting the release of ADP from the HSP70 and HSC70 proteins thereby triggering client/substrate protein release. Nucleotide release is mediated via its binding to the nucleotide-binding domain (NBD) of HSPA8/HSC70 where as the substrate release is mediated via its binding to the substrate-binding domain (SBD) of HSPA8/HSC70. Inhibits the pro-apoptotic function of PPP1R15A, and has anti-apoptotic activity. Markedly increases the anti-cell death function of BCL2 induced by various stimuli. Involved in the STUB1-mediated proteasomal degradation of ESR1 in response to age-related circulating estradiol (17-beta-estradiol/E2) decline, thereby promotes neuronal apoptosis in response to ischemic reperfusion injury.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2791
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat