Antibodies
Anti-BAG3 Antibody-Oligo Conjugate
SKU: aoc1305
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAG3 Antibody-IF1
Antibody Target
- Target
- BAG family molecular chaperone regulator 3
- UniProt Number
- O95817
- Target Description
- Co-chaperone and adapter protein that connects different classes of molecular chaperones including heat shock proteins 70 (HSP70s), e.g. HSPA1A/HSP70 or HSPA8/HSC70, and small heat shock proteins (sHSPs), e.g. HSPB8. Acts as a nucleotide-exchange factor (NEF) promoting the release of ADP from HSP70s, thereby triggering client protein release. Nucleotide release is mediated via BAG3 binding to the nucleotide-binding domain (NBD) of HSP70s, whereas client release is mediated via binding to the substrate-binding domain (SBD). Has anti-apoptotic activity. Plays a role in the HSF1 nucleocytoplasmic transport.
- Molecular Weight
- 62kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1104
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse