Antibodies
Anti-BAK Antibody-Oligo Conjugate
SKU: aoc1307
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAK Antibody-IF1
Antibody Target
- Target
- Bcl-2 homologous antagonist/killer
- UniProt Number
- Q16611
- Target Description
- Plays a role in the mitochondrial apoptotic process. Upon arrival of cell death signals, promotes mitochondrial outer membrane (MOM) permeabilization by oligomerizing to form pores within the MOM. This releases apoptogenic factors into the cytosol, including cytochrome c, promoting the activation of caspase 9 which in turn processes and activates the effector caspases.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54625
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMonkey