Antibodies
Anti-BAP31 Antibody-Oligo Conjugate
SKU: aoc1308
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAP31 Antibody-IF1
Antibody Target
- Target
- B-cell receptor-associated protein 31
- UniProt Number
- P51572
- Target Description
- Functions as a chaperone protein (PubMed:18287538, PubMed:9396746). Is one of the most abundant endoplasmic reticulum (ER) proteins (PubMed:18287538, PubMed:9396746). Plays a role in the export of secreted proteins in the ER, the recognition of abnormally folded protein and their targeting to the ER associated-degradation (ERAD) (PubMed:18287538, PubMed:9396746). Also serves as a cargo receptor for the export of transmembrane proteins (By similarity). Plays a role in the assembly of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) by stimulating the translocation of NDUFS4 and NDUFB11 from the cytosol to the mitochondria via interaction with TOMM40 (PubMed:31206022). In response to ER stress, delocalizes from the ER-mitochondria contact sites and binds BCL2 (PubMed:31206022). May be involved in CASP8-mediated apoptosis (PubMed:10958671)..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1894
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat