Antibodies
Anti-BAX Antibody-Oligo Conjugate
SKU: aoc1309
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BAX Antibody-IF1
Antibody Target
- Target
- Apoptosis regulator BAX
- UniProt Number
- Q07812
- Target Description
- Plays a role in the mitochondrial apoptotic process (PubMed:10772918, PubMed:11060313, PubMed:16113678, PubMed:16199525, PubMed:18948948, PubMed:21199865, PubMed:21458670, PubMed:25609812, PubMed:36361894, PubMed:8358790, PubMed:8521816). Under normal conditions, BAX is largely cytosolic via constant retrotranslocation from mitochondria to the cytosol mediated by BCL2L1/Bcl-xL, which avoids accumulation of toxic BAX levels at the mitochondrial outer membrane (MOM) (PubMed:21458670). Under stress conditions, undergoes a conformation change that causes translocation to the mitochondrion membrane, leading to the release of cytochrome c that then triggers apoptosis (PubMed:10772918, PubMed:11060313, PubMed:16113678, PubMed:16199525, PubMed:18948948, PubMed:21199865, PubMed:21458670, PubMed:25609812, PubMed:8358790, PubMed:8521816). Promotes activation of CASP3, and thereby apoptosis (PubMed:10772918, PubMed:11060313, PubMed:16113678, PubMed:16199525, PubMed:18948948, PubMed:21199865, PubMed:21458670, PubMed:25609812, PubMed:8358790, PubMed:8521816)..
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC5006-06
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human