Antibodies
Anti-BCAM Antibody-Oligo Conjugate (ARC61183)
SKU: aoc1312
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BCAM Antibody (ARC61183)-IF1
Antibody Target
- Target
- Basal cell adhesion molecule
- UniProt Number
- P50895
- Target Description
- Transmembrane glycoprotein that functions as both a receptor and an adhesion molecule playing a crucial role in cell adhesion, motility, migration and invasion. Extracellular domain enables binding to extracellular matrix proteins, such as laminin, integrin and other ligands while its intracellular domain interacts with cytoskeletal proteins like hemoglobin, facilitating cell signal transduction. Serves as a receptor for laminin alpha-5/LAMA5 to promote cell adhesion. Mechanistically, JAK2 induces BCAM phosphorylation and activates its adhesion to laminin by stimulating a Rap1/AKT signaling pathway in the absence of EPOR.
- Molecular Weight
- 67kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61183
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant fusion protein containing a sequence corresponding to amino acids 32-547 of human CD239/BCAM. (NP_005572.2).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human