Antibodies
Anti-BCAM Antibody-Oligo Conjugate (ARC61183)
SKU: aoc1312
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BCAM Antibody (ARC61183)-IF1
Antibody Target
- Target
- Basal cell adhesion molecule
- UniProt Number
- P50895
- Target Description
- Transmembrane glycoprotein that functions as both a receptor and an adhesion molecule playing a crucial role in cell adhesion, motility, migration and invasion (PubMed:9616226, PubMed:31413112). Extracellular domain enables binding to extracellular matrix proteins, such as laminin, integrin and other ligands while its intracellular domain interacts with cytoskeletal proteins like hemoglobin, facilitating cell signal transduction (PubMed:17158232). Serves as a receptor for laminin alpha-5/LAMA5 to promote cell adhesion (PubMed:15975931). Mechanistically, JAK2 induces BCAM phosphorylation and activates its adhesion to laminin by stimulating a Rap1/AKT signaling pathway in the absence of EPOR (PubMed:23160466)..
- Molecular Weight
- 67kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61183
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant fusion protein containing a sequence corresponding to amino acids 32-547 of human CD239/BCAM. (NP_005572.2).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human