Antibodies
Anti-BCKDHB Antibody-Oligo Conjugate (ARC62319)
SKU: aoc1314
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BCKDHB Antibody (ARC62319)-IF1
Antibody Target
- Target
- 2-oxoisovalerate dehydrogenase subunit beta, mitochondrial
- UniProt Number
- P21953
- Target Description
- Together with BCKDHA forms the heterotetrameric E1 subunit of the mitochondrial branched-chain alpha-ketoacid dehydrogenase (BCKD) complex. The BCKD complex catalyzes the multi-step oxidative decarboxylation of alpha-ketoacids derived from the branched-chain amino-acids valine, leucine and isoleucine producing CO2 and acyl-CoA which is subsequently utilized to produce energy. The E1 subunit catalyzes the first step with the decarboxylation of the alpha-ketoacid forming an enzyme-product intermediate. A reductive acylation mediated by the lipoylamide cofactor of E2 extracts the acyl group from the E1 active site for the next step of the reaction..
- Molecular Weight
- 43 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62319
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat