Antibodies
Anti-Bcl-2 Antibody-Oligo Conjugate
SKU: aoc1320
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Bcl-2 Antibody-IF1
Antibody Target
- Target
- Apoptosis regulator Bcl-2
- UniProt Number
- P10415
- Target Description
- Suppresses apoptosis in a variety of cell systems including factor-dependent lymphohematopoietic and neural cells (PubMed:1508712, PubMed:8183370). Regulates cell death by controlling the mitochondrial membrane permeability (PubMed:11368354). Appears to function in a feedback loop system with caspases (PubMed:11368354). Inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor (APAF-1) (PubMed:11368354). Also acts as an inhibitor of autophagy: interacts with BECN1 and AMBRA1 during non-starvation conditions and inhibits their autophagy function (PubMed:18570871, PubMed:20889974, PubMed:21358617). May attenuate inflammation by impairing NLRP1-inflammasome activation, hence CASP1 activation and IL1B release (PubMed:17418785)..
- Molecular Weight
- 26 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- AMC0441
- Isotype
- IgG1Kappa
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat