Antibodies
Anti-BCL11A Antibody-Oligo Conjugate
SKU: aoc1318
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BCL11A Antibody-IF1
Antibody Target
- Target
- BCL11 transcription factor A
- UniProt Number
- Q9H165
- Target Description
- Transcription factor. Associated with the BAF SWI/SNF chromatin remodeling complex. Binds to the 5'-TGACCA-3' sequence motif in regulatory regions of target genes, including a distal promoter of the HBG1 hemoglobin subunit gamma-1 gene. Involved in regulation of the developmental switch from gamma- to beta-globin, probably via direct repression of HBG1; hence indirectly repressing fetal hemoglobin (HbF) level. Involved in brain development. May play a role in hematopoiesis. Essential factor in lymphopoiesis required for B-cell formation in fetal liver. May function as a modulator of the transcriptional repression activity of NR2F2.
- Molecular Weight
- 91kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1486
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat