Antibodies
Anti-BCL11B Antibody-Oligo Conjugate
SKU: aoc1319
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BCL11B Antibody-IF1
Antibody Target
- Target
- B-cell lymphoma/leukemia 11B
- UniProt Number
- Q9C0K0
- Target Description
- Key regulator of both differentiation and survival of T-lymphocytes during thymocyte development in mammals. Essential in controlling the responsiveness of hematopoietic stem cells to chemotactic signals by modulating the expression of the receptors CCR7 and CCR9, which direct the movement of progenitor cells from the bone marrow to the thymus. Is a regulator of IL2 promoter and enhances IL2 expression in activated CD4(+) T-lymphocytes. Tumor-suppressor that represses transcription through direct, TFCOUP2-independent binding to a GC-rich response element. May also function in the P53-signaling pathway.
- Molecular Weight
- 96kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2329
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse