Antibodies
Anti-BclXL Antibody-Oligo Conjugate
SKU: aoc1325
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BclXL Antibody-IF1
Antibody Target
- Target
- Bcl-2-like protein 1
- UniProt Number
- Q07817
- Target Description
- Potent inhibitor of cell death. Inhibits activation of caspases. Appears to regulate cell death by blocking the voltage-dependent anion channel (VDAC) by binding to it and preventing the release of the caspase activator, CYC1, from the mitochondrial membrane. Also acts as a regulator of G2 checkpoint and progression to cytokinesis during mitosis.; FUNCTION: Isoform Bcl-X(L) also regulates presynaptic plasticity, including neurotransmitter release and recovery, number of axonal mitochondria as well as size and number of synaptic vesicle clusters. During synaptic stimulation, increases ATP availability from mitochondria through regulation of mitochondrial membrane ATP synthase F(1)F(0) activity and regulates endocytic vesicle retrieval in hippocampal neurons through association with DMN1L and stimulation of its GTPase activity in synaptic vesicles. May attenuate inflammation impairing NLRP1-inflammasome activation, hence CASP1 activation and IL1B release (PubMed:17418785)..; FUNCTION: Isoform Bcl-X(S) promotes apoptosis.
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52299
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat