Antibodies
Anti-beta 2 Microglobulin Antibody-Oligo Conjugate (ARC0656)
SKU: aoc1330
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-beta 2 Microglobulin Antibody (ARC0656)-IF1
Antibody Target
- Target
- Beta-2-microglobulin [Cleaved into: Beta-2-microglobulin form pI 5.3]
- UniProt Number
- P61769
- Target Description
- Component of the class I major histocompatibility complex (MHC). Involved in the presentation of peptide antigens to the immune system. Exogenously applied M.tuberculosis EsxA or EsxA-EsxB (or EsxA expressed in host) binds B2M and decreases its export to the cell surface (total protein levels do not change), probably leading to defects in class I antigen presentation.
- Molecular Weight
- 14kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0656
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat