Antibodies
Anti-beta Actin Antibody-Oligo Conjugate (AMC0001)
SKU: aoc1002
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-beta Actin Antibody (AMC0001)-IF1
Antibody Target
- Target
- Actin, cytoplasmic 1
- UniProt Number
- P60709
- Target Description
- Actin is a highly conserved protein that polymerizes to produce filaments that form cross-linked networks in the cytoplasm of cells (PubMed:25255767, PubMed:29581253). Actin exists in both monomeric (G-actin) and polymeric (F-actin) forms, both forms playing key functions, such as cell motility and contraction (PubMed:29581253). In addition to their role in the cytoplasmic cytoskeleton, G- and F-actin also localize in the nucleus, and regulate gene transcription and motility and repair of damaged DNA (PubMed:29925947). Plays a role in the assembly of the gamma-tubulin ring complex (gTuRC), which regulates the minus-end nucleation of alpha-beta tubulin heterodimers that grow into microtubule protafilaments (PubMed:39321809, PubMed:38609661). Part of the ACTR1A/ACTB filament around which the dynactin complex is built (By similarity). The dynactin multiprotein complex activates the molecular motor dynein for ultra-processive transport along microtubules (By similarity)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- AMC0001
- Isotype
- IgG1Kappa
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat