Antibodies
Anti-beta Galactosidase Antibody-Oligo Conjugate
SKU: aoc1332
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-beta Galactosidase Antibody-IF1
Antibody Target
- Target
- Beta-galactosidase
- UniProt Number
- P16278
- Target Description
- [Isoform 1]: Cleaves beta-linked terminal galactosyl residues from gangliosides, glycoproteins, and glycosaminoglycans..; FUNCTION: [Isoform 2]: Has no beta-galactosidase catalytic activity, but plays functional roles in the formation of extracellular elastic fibers (elastogenesis) and in the development of connective tissue. Seems to be identical to the elastin-binding protein (EBP), a major component of the non-integrin cell surface receptor expressed on fibroblasts, smooth muscle cells, chondroblasts, leukocytes, and certain cancer cell types. In elastin producing cells, associates with tropoelastin intracellularly and functions as a recycling molecular chaperone which facilitates the secretions of tropoelastin and its assembly into elastic fibers..
- Molecular Weight
- 60kDa/72kDa/76kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61596
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat