Antibodies
Anti-beta III Tubulin Antibody-Oligo Conjugate (AMC0115)
SKU: aoc1335
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-beta III Tubulin Antibody (AMC0115)-IF1
Antibody Target
- Target
- Tubulin beta-3 chain
- UniProt Number
- Q13509
- Target Description
- Tubulin is the major constituent of microtubules, protein filaments consisting of alpha- and beta-tubulin heterodimers. Microtubules grow by the addition of GTP-tubulin dimers to the microtubule end, where a stabilizing cap forms. Below the cap, alpha-beta tubulin heterodimers are in GDP-bound state, owing to GTPase activity of alpha-tubulin. TUBB3 plays a critical role in proper axon guidance and maintenance. Binding of NTN1/Netrin-1 to its receptor UNC5C might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion. Plays a role in dorsal root ganglion axon projection towards the spinal cord.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-FIF-PIHCELISA
- Clone
- AMC0115
- Isotype
- IgG2b
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat