Antibodies
Anti-BIN1 Antibody-Oligo Conjugate (ARC65289)
SKU: aoc1341
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BIN1 Antibody (ARC65289)-IF1
Antibody Target
- Target
- Myc box-dependent-interacting protein 1
- UniProt Number
- O00499
- Target Description
- Is a key player in the control of plasma membrane curvature, membrane shaping and membrane remodeling. Required in muscle cells for the formation of T-tubules, tubular invaginations of the plasma membrane that function in depolarization-contraction coupling (PubMed:24755653). Is a negative regulator of endocytosis (By similarity). Is also involved in the regulation of intracellular vesicles sorting, modulation of BACE1 trafficking and the control of amyloid-beta production (PubMed:27179792). In neuronal circuits, endocytosis regulation may influence the internalization of PHF-tau aggregates (By similarity). May be involved in the regulation of MYC activity and the control cell proliferation (PubMed:8782822). Has actin bundling activity and stabilizes actin filaments against depolymerization in vitro (PubMed:28893863)..
- Molecular Weight
- 65kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC65289
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat