Antibodies
Anti-BMP2 Antibody-Oligo Conjugate
SKU: aoc1345
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BMP2 Antibody-IF1
Antibody Target
- Target
- Bone morphogenetic protein 2
- UniProt Number
- P12643
- Target Description
- Growth factor of the TGF-beta superfamily that plays essential roles in many developmental processes, including cardiogenesis, neurogenesis, and osteogenesis (PubMed:18436533, PubMed:24362451, PubMed:31019025). Induces cartilage and bone formation (PubMed:3201241). Initiates the canonical BMP signaling cascade by associating with type I receptor BMPR1A and type II receptor BMPR2 (PubMed:15064755, PubMed:17295905, PubMed:18436533). Once all three components are bound together in a complex at the cell surface, BMPR2 phosphorylates and activates BMPR1A (PubMed:7791754). In turn, BMPR1A propagates signal by phosphorylating SMAD1/5/8 that travel to the nucleus and act as activators and repressors of transcription of target genes. Also acts to promote expression of HAMP, via the interaction with its receptor BMPR1A/ALK3 (PubMed:31800957). Can also signal through non-canonical pathways such as ERK/MAP kinase signaling cascade that regulates osteoblast differentiation (PubMed:16771708, PubMed:20851880). Also stimulates the differentiation of myoblasts into osteoblasts via the EIF2AK3-EIF2A-ATF4 pathway by stimulating EIF2A phosphorylation which leads to increased expression of ATF4 which plays a central role in osteoblast differentiation (PubMed:24362451). Acts as a positive regulator of odontoblast differentiation during mesenchymal tooth germ formation, expression is repressed during the bell stage by MSX1-mediated inhibition of CTNNB1 signaling (By similarity)..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC3314
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat