Antibodies
Anti-BMP4 Antibody-Oligo Conjugate
SKU: aoc1346
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BMP4 Antibody-IF1
Antibody Target
- Target
- Bone morphogenetic protein 4
- UniProt Number
- P12644
- Target Description
- Growth factor of the TGF-beta superfamily that plays essential roles in many developmental processes, including neurogenesis, vascular development, angiogenesis and osteogenesis. Acts in concert with PTHLH/PTHRP to stimulate ductal outgrowth during embryonic mammary development and to inhibit hair follicle induction. Initiates the canonical BMP signaling cascade by associating with type I receptor BMPR1A and type II receptor BMPR2. Once all three components are bound together in a complex at the cell surface, BMPR2 phosphorylates and activates BMPR1A. In turn, BMPR1A propagates signal by phosphorylating SMAD1/5/8 that travel to the nucleus and act as activators and repressors of transcription of target genes. Positively regulates the expression of odontogenic development regulator MSX1 via inducing the IPO7-mediated import of SMAD1 to the nucleus. Required for MSX1-mediated mesenchymal molar tooth bud development beyond the bud stage, via promoting Wnt signaling. Acts as a positive regulator of odontoblast differentiation during mesenchymal tooth germ formation, expression is repressed during the bell stage by MSX1-mediated inhibition of CTNNB1 signaling. Able to induce its own expression in dental mesenchymal cells and also in the neighboring dental epithelial cells via an MSX1-mediated pathway. Can also signal through non-canonical BMP pathways such as ERK/MAP kinase, PI3K/Akt, or SRC cascades. For example, induces SRC phosphorylation which, in turn, activates VEGFR2, leading to an angiogenic response.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0587
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human