Antibodies
Anti-BMP6 Antibody-Oligo Conjugate
SKU: aoc1347
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BMP6 Antibody-IF1
Antibody Target
- Target
- Bone morphogenetic protein 6
- UniProt Number
- P22004
- Target Description
- Growth factor of the TGF-beta superfamily that plays essential roles in many developmental processes including cartilage and bone formation (PubMed:31019025). Also plays an important role in the regulation of HAMP/hepcidin expression and iron metabolism by acting as a ligand for hemojuvelin/HJV (PubMed:26582087). Also acts to promote expression of HAMP, potentially via the interaction with its receptor BMPR1A/ALK3 (PubMed:30097509, PubMed:31800957). Initiates the canonical BMP signaling cascade by associating with type I receptor ACVR1 and type II receptor ACVR2B (PubMed:18070108). In turn, ACVR1 propagates signal by phosphorylating SMAD1/5/8 that travel to the nucleus and act as activators and repressors of transcription of target. Can also signal through non-canonical pathway such as TAZ-Hippo signaling cascade to modulate VEGF signaling by regulating VEGFR2 expression (PubMed:33021694)..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1025
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat