Antibodies
Anti-BNIP1 Antibody-Oligo Conjugate
SKU: aoc1348
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BNIP1 Antibody-IF1
Antibody Target
- Target
- Vesicle transport protein SEC20
- UniProt Number
- Q12981
- Target Description
- As part of a SNARE complex may be involved in endoplasmic reticulum membranes fusion and be required for the maintenance of endoplasmic reticulum organization (PubMed:15272311). Also plays a role in apoptosis (PubMed:15272311, PubMed:23896122, PubMed:7954800). It is for instance required for endoplasmic reticulum stress-induced apoptosis (PubMed:23896122). As a substrate of RNF185 interacting with SQSTM1, might also be involved in mitochondrial autophagy (Probable)..
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2137
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat