Antibodies
Anti-BOB1 Antibody-Oligo Conjugate
SKU: aoc1349
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BOB1 Antibody-IF1
Antibody Target
- Target
- POU domain class 2-associating factor 1
- UniProt Number
- Q16633
- Target Description
- Transcriptional coactivator that specifically associates with either POU2F1/OCT1 or POU2F2/OCT2. It boosts the POU2F1/OCT1 mediated promoter activity and to a lesser extent, that of POU2F2/OCT2. It recognizes the POU domains of POU2F1/OCT1 and POU2F2/OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers. Regulates IL6 expression in B cells as POU2F2/OCT2 coactivator.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC72499
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat