Antibodies
Anti-BRAF Antibody-Oligo Conjugate
SKU: aoc1353
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BRAF Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase B-raf
- UniProt Number
- P15056
- Target Description
- Protein kinase involved in the transduction of mitogenic signals from the cell membrane to the nucleus (Probable). Phosphorylates MAP2K1, and thereby activates the MAP kinase signal transduction pathway. Phosphorylates PFKFB2. May play a role in the postsynaptic responses of hippocampal neurons.
- Molecular Weight
- 84kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC62593
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human