Antibodies

Anti-BRD4 Antibody-Oligo Conjugate

SKU: aoc1355

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-BRD4 Antibody-IF1

Antibody Target

Target
Bromodomain-containing protein 4
UniProt Number
O60885
Target Description
Chromatin reader protein that recognizes and binds acetylated histones and plays a key role in transmission of epigenetic memory across cell divisions and transcription regulation (PubMed:20871596, PubMed:23086925, PubMed:23317504, PubMed:29176719, PubMed:29379197). Remains associated with acetylated chromatin throughout the entire cell cycle and provides epigenetic memory for postmitotic G1 gene transcription by preserving acetylated chromatin status and maintaining high-order chromatin structure (PubMed:22334664, PubMed:23317504, PubMed:23589332). During interphase, plays a key role in regulating the transcription of signal-inducible genes by associating with the P-TEFb complex and recruiting it to promoters (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). Also recruits P-TEFb complex to distal enhancers, so called anti-pause enhancers in collaboration with JMJD6 (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). BRD4 and JMJD6 are required to form the transcriptionally active P-TEFb complex by displacing negative regulators such as HEXIM1 and 7SKsnRNA complex from P-TEFb, thereby transforming it into an active form that can then phosphorylate the C-terminal domain (CTD) of RNA polymerase II (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). Regulates differentiation of naive CD4(+) T-cells into T-helper Th17 by promoting recruitment of P-TEFb to promoters (By similarity). Promotes phosphorylation of 'Ser-2' of the C-terminal domain (CTD) of RNA polymerase II (PubMed:23086925). According to a report, directly acts as an atypical protein kinase and mediates phosphorylation of 'Ser-2' of the C-terminal domain (CTD) of RNA polymerase II; these data however need additional evidences in vivo (PubMed:22509028). In addition to acetylated histones, also recognizes and binds acetylated RELA, leading to further recruitment of the P-TEFb complex and subsequent activation of NF-kappa-B (PubMed:19103749). Also acts as a regulator of p53/TP53-mediated transcription: following phosphorylation by CK2, recruited to p53/TP53 specific target promoters (PubMed:23317504)..; FUNCTION: [Isoform B]: Acts as a chromatin insulator in the DNA damage response pathway. Inhibits DNA damage response signaling by recruiting the condensin-2 complex to acetylated histones, leading to chromatin structure remodeling, insulating the region from DNA damage response by limiting spreading of histone H2AX/H2A.x phosphorylation..
Molecular Weight
152kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0699
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human