Antibodies
Anti-BRD4 Antibody-Oligo Conjugate
SKU: aoc1355
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BRD4 Antibody-IF1
Antibody Target
- Target
- Bromodomain-containing protein 4
- UniProt Number
- O60885
- Target Description
- Chromatin reader protein that recognizes and binds acetylated histones and plays a key role in transmission of epigenetic memory across cell divisions and transcription regulation (PubMed:20871596, PubMed:23086925, PubMed:23317504, PubMed:29176719, PubMed:29379197). Remains associated with acetylated chromatin throughout the entire cell cycle and provides epigenetic memory for postmitotic G1 gene transcription by preserving acetylated chromatin status and maintaining high-order chromatin structure (PubMed:22334664, PubMed:23317504, PubMed:23589332). During interphase, plays a key role in regulating the transcription of signal-inducible genes by associating with the P-TEFb complex and recruiting it to promoters (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). Also recruits P-TEFb complex to distal enhancers, so called anti-pause enhancers in collaboration with JMJD6 (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). BRD4 and JMJD6 are required to form the transcriptionally active P-TEFb complex by displacing negative regulators such as HEXIM1 and 7SKsnRNA complex from P-TEFb, thereby transforming it into an active form that can then phosphorylate the C-terminal domain (CTD) of RNA polymerase II (PubMed:16109376, PubMed:16109377, PubMed:19596240, PubMed:23589332, PubMed:24360279). Regulates differentiation of naive CD4(+) T-cells into T-helper Th17 by promoting recruitment of P-TEFb to promoters (By similarity). Promotes phosphorylation of 'Ser-2' of the C-terminal domain (CTD) of RNA polymerase II (PubMed:23086925). According to a report, directly acts as an atypical protein kinase and mediates phosphorylation of 'Ser-2' of the C-terminal domain (CTD) of RNA polymerase II; these data however need additional evidences in vivo (PubMed:22509028). In addition to acetylated histones, also recognizes and binds acetylated RELA, leading to further recruitment of the P-TEFb complex and subsequent activation of NF-kappa-B (PubMed:19103749). Also acts as a regulator of p53/TP53-mediated transcription: following phosphorylation by CK2, recruited to p53/TP53 specific target promoters (PubMed:23317504)..; FUNCTION: [Isoform B]: Acts as a chromatin insulator in the DNA damage response pathway. Inhibits DNA damage response signaling by recruiting the condensin-2 complex to acetylated histones, leading to chromatin structure remodeling, insulating the region from DNA damage response by limiting spreading of histone H2AX/H2A.x phosphorylation..
- Molecular Weight
- 152kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0699
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human