Antibodies
Anti-BRG1 Antibody-Oligo Conjugate
SKU: aoc1357
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BRG1 Antibody-IF1
Antibody Target
- Target
- SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4
- UniProt Number
- P51532
- Target Description
- ATPase involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner (PubMed:15075294, PubMed:29374058, PubMed:30339381, PubMed:32459350). Component of the CREST-BRG1 complex, a multiprotein complex that regulates promoter activation by orchestrating the calcium-dependent release of a repressor complex and the recruitment of an activator complex. In resting neurons, transcription of the c-FOS promoter is inhibited by SMARCA4-dependent recruitment of a phospho-RB1-HDAC repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex. At the same time, there is increased recruitment of CREBBP to the promoter by a CREST-dependent mechanism, which leads to transcriptional activation. The CREST-BRG1 complex also binds to the NR2B promoter, and activity-dependent induction of NR2B expression involves the release of HDAC1 and recruitment of CREBBP (By similarity). Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development, a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. SMARCA4/BAF190A may promote neural stem cell self-renewal/proliferation by enhancing Notch-dependent proliferative signals, while concurrently making the neural stem cell insensitive to SHH-dependent differentiating cues (By similarity). Acts as a corepressor of ZEB1 to regulate E-cadherin transcription and is required for induction of epithelial-mesenchymal transition (EMT) by ZEB1 (PubMed:20418909). Binds via DLX1 to enhancers located in the intergenic region between DLX5 and DLX6 and this binding is stabilized by the long non-coding RNA (lncRNA) Evf2 (By similarity). Binds to RNA in a promiscuous manner (By similarity). In brown adipose tissue, involved in the regulation of thermogenic genes expression (By similarity)..
- Molecular Weight
- 185 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC0035
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat