Antibodies
Anti-BRMS1 Antibody-Oligo Conjugate
SKU: aoc1358
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BRMS1 Antibody-IF1
Antibody Target
- Target
- Breast cancer metastasis-suppressor 1
- UniProt Number
- Q9HCU9
- Target Description
- Transcriptional repressor. Down-regulates transcription activation by NF-kappa-B by promoting the deacetylation of RELA at 'Lys-310'. Promotes HDAC1 binding to promoter regions. Down-regulates expression of anti-apoptotic genes that are controlled by NF-kappa-B. Promotes apoptosis in cells that have inadequate adherence to a substrate, a process called anoikis, and may thereby inhibit metastasis. May be a mediator of metastasis suppression in breast carcinoma..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2536
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat